On-target is the proportion of detected RI reference genomes assigned to the target; RI genome sensitivity is the proportion of target RI reference genomes detected.
Primer Species LP RP Tml Tmr Length Score ⇅ On-target ⇅ RI genome sensitivity ⇅
Primer 1281 Sporanaerobacter acetigenes GGTGCCACAGAGGGGATTA ACTTCCCTCTTTTGGTGGAAC 58.69 58.05 168 8
100.00% Complete
100.00%
100.00% Complete
100.00%